Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (2025)

Question

Question asked by Filo student

Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (1)

Views: 5,087 students

Updated on: Nov 13, 2024

Not the question you're searching for?

+ Ask your question

Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (3)

Filo tutor solution

Learn from their 1-to-1 discussion with Filo tutors.

Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (4)

Generate FREE solution for this question from our expert tutors in next 60 seconds

Don't let anything interrupt your homework or exam prep with world’s only instant-tutoring, available 24x7

Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (5)Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (6)Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (7)

Found

3

tutors discussing this question

Benjamin

Discussed

Sodium moves across membrane by: Diffusion (D) Anti transportation (B) Osmosis (E) ATP mediated transport (Exogenous transport)17. Which of the following substances would pass through cytoplasmic membrane without active transport? (402 DJAn enzyme (B) Glucose (E) All would pass through membrane without active transport (C) Cat18. Reduced NADH - generated at all the following steps except: (A) When pyruvate is decarboxylated in the production of acetyl-CoA (B) The oxidation/reduction steps in Glycolysis (C) The formation of ethanol from acetaldehyde (D) Oxidation steps in Kreb's Cycle (E) NADH is generated in all of the above stepsOne thing different about the NADH produced in Glycolysis that is not true in the Mitochondrial matrix is: (A) NADH in Glycolysis must be transported into mitochondria (B) NADH in Glycolysis makes more ATP equivalents than those in the mitochondria (C) NADH must be first converted to NADPH (D) NADH is never oxidized in the cytoplasm (E) None are true20. Why do we make lactic acid and anaerobic yeast make ethanol? (A) It is used to make amino acids (B) It is used directly to make ATP (C) It is used to store energy (D) It is used to reoxidize NADH (E) It is used to make new membrane material21. The Pentose Phosphate Pathway is important for making what molecule? (A) ATP (D) Acetyl-CoA (B) GTP (E) All the above (C) NADPHProtons between the two membranes of the mitochondria: (A) Want to reenter the matrix (D) Can be used for other functions (B) Can be used to make ATP (E) All are true (C) Can be used for transportation

15

mins ago

Discuss this question LIVE

15

mins ago

Practice more questions on All topics

Question 1EasyViews: 5,677

What are the two functions of ear?

Topic: Structural Organization in Animals Book: Modern ABC Biology Class 11 Part 1 (Modern ABC)
View 2 solutions
Question 2EasyViews: 5,382One of the following does the same work as is done by nephridia in earthworm.Flame cells in liverflukeMyotomes in fishStatocysts ir prawnParotid gland in toad
Topic: Excretory Products and their Elimination Book: Precalculus
View solution
Question 3EasyViews: 6,063The tissue which covers the external surface of the animal body and the internal surface of visceral organs isepithelial tissueconnective tissueadipose tissueNone of these
Topic: Structural Organization in Animals Book: CBSE New Pattern Biology Class 11 for 2021-22 Exam MCQs based book for Term 1
View solution
Question 4EasyViews: 6,090The amount of liquid filtered by glomeruli of kidney in a 24 hours period is170 litres100 litres200−250cc500−1000cc
Topic: Excretory Products and their Elimination Book: Biology-for-NEET-Volume-1-Class-XI
View solution

View more

Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (20)

Students who ask this question also asked

Question 1Views: 5,307

A unique feature of (blank) is that they are tissue-specific for cell biology.

Topic: Biology
View solution
Question 2Views: 5,045

Shintya menanam padi dalam pot. Pada awal pengukuran, tinggi padi yaitu 2 cm dari permukaan tanah. Selang 1 minggu kemudian, ternyata tingginya menjadi 12,5 cm. Berapa laju pertumbuhannya

Topic: Biology
View solution
Question 3Views: 5,054Part IV: The Cloning Process The basic mechanisms of DNA replication, transcription, and translation are understood by the Baroness. She has now seen the application, transcription, and translation. Now you are ready to explain the cloning process proposed by the Kenmore lab. You have drawn a really nice diagram showing the circular plasmid that allows E. coli to produce your goal. Explain why each labeled section is important. Figure 1 depicts the cloning schema. Questions:Analysis of the cloning vector: First, you point to the plasmid vector, pCKI#lacZ. What is the function of each labeled section? How will each section be important for the cloning experiment?Review of the cloning process: During which step in the diagram would DNA ligase be used (1, 2, 3, 4, or 5)?During which step in the diagram would restriction endonuclease be used?During which step in the diagram would the ampicillin resistance gene be important?Which step represents the transformation of a bacterial cell?What might be added to the growth medium to ensure expression of the ProCAB operon?
Topic: Biology
View solution
Question 4Views: 5,655Which of the following repair mechanisms would most likely correct the missense mutation that was caused by deamination of the second C in the top strand of the sequence below? (the sequence is broken into triplets only for ease of reading) 5' GGCTATCTTCGTCGGATCTCA 3' CCGATAGCCGCAGCCTAGAGT recombinationnon-homologous end joining (NHEJ)mismatch repairnucleotide excision repair
Topic: Biology
View solution

View more

Question Text

Sodium moves across membrane by: Diffusion (D) Anti transportation (B) Osmosis (E) ATP mediated transport (Exogenous transport)17. Which of the following substances would pass through cytoplasmic membrane without active transport? (402 DJAn enzyme (B) Glucose (E) All would pass through membrane without active transport (C) Cat18. Reduced NADH - generated at all the following steps except: (A) When pyruvate is decarboxylated in the production of acetyl-CoA (B) The oxidation/reduction steps in Glycolysis (C) The formation of ethanol from acetaldehyde (D) Oxidation steps in Kreb's Cycle (E) NADH is generated in all of the above stepsOne thing different about the NADH produced in Glycolysis that is not true in the Mitochondrial matrix is: (A) NADH in Glycolysis must be transported into mitochondria (B) NADH in Glycolysis makes more ATP equivalents than those in the mitochondria (C) NADH must be first converted to NADPH (D) NADH is never oxidized in the cytoplasm (E) None are true20. Why do we make lactic acid and anaerobic yeast make ethanol? (A) It is used to make amino acids (B) It is used directly to make ATP (C) It is used to store energy (D) It is used to reoxidize NADH (E) It is used to make new membrane material21. The Pentose Phosphate Pathway is important for making what molecule? (A) ATP (D) Acetyl-CoA (B) GTP (E) All the above (C) NADPHProtons between the two membranes of the mitochondria: (A) Want to reenter the matrix (D) Can be used for other functions (B) Can be used to make ATP (E) All are true (C) Can be used for transportation

Updated OnNov 13, 2024
TopicAll topics
SubjectBiology
ClassClass 11
Sodium moves across membrane by: Diffusion (D) Anti transportat... | Filo (2025)
Top Articles
Latest Posts
Recommended Articles
Article information

Author: Corie Satterfield

Last Updated:

Views: 6600

Rating: 4.1 / 5 (62 voted)

Reviews: 85% of readers found this page helpful

Author information

Name: Corie Satterfield

Birthday: 1992-08-19

Address: 850 Benjamin Bridge, Dickinsonchester, CO 68572-0542

Phone: +26813599986666

Job: Sales Manager

Hobby: Table tennis, Soapmaking, Flower arranging, amateur radio, Rock climbing, scrapbook, Horseback riding

Introduction: My name is Corie Satterfield, I am a fancy, perfect, spotless, quaint, fantastic, funny, lucky person who loves writing and wants to share my knowledge and understanding with you.